week 7
Week of 12/16 – 12/22
12/16 – Monday – Period 7,8-
1: Data Collection of Crime Scene Lab, gels
2. Fly’s~
12/16 – Monday Homework:
1: Complete questions on DNA Fingerprinting lab on page 12 – Due Friday 12/21
You should have the following pages completed and handed in by Friday!
Pages: 1,3,4 (Skip page 8 questions. Put a Y through page 8) 12, 18, 21, 22, 23, and 24.
2: Please read the pGlO lab (transformation lab) pages 1 – 11 and answer the form below:
Transformation Lab instructions – student manual.pdf
View Download
pGLO Bacterial Transformation 1920
12/17 – Tuesday – Period 7 – Academic Study Hall
Period 8
1: complete the Crime Scene Lab
2: Take out parents of our Drosophila cross so that they do not mate with the offspring!!
3: pGlo Transformation Lab-
a) obtain 2 micro test tubes, one labeled +pGlo and the other -pGlo
Little p means plasmid – small circular DNA of E. Coli.
b) Obtain your starter plates that you streaked yesterday that has been incubating for 24 hours at 37 degrees
Celsius.
c) Use a sterile loop and pick up a single colony and disperse into each tube, +pGLO and -pGlo.
d) I will add 10 micro liters of the pGlo plasmid (engineered sequence) to your +pGLO micro test tube.
e) Incubate the tubes on ice for 10 minutes.
f) label your lids.
g) heat shock, add broth, pippete and streak in the appropriate plates.
f) Stack up the plates, tape and label, then incubate for 24 hours.
12/17 – Tuesday – Homework:
1: Please make a second submission to last nights pGlo’s form.
2: Please answer question in PGlo lab packet page 3 (questions 1 – 4) and page 12 (questions 1 – 4)
THis lab Packet is due this Friday!
3: Please complete form below based on Chapter 20 of your text:
Biotechnology Form 1 – 1920
12/18 – Wednesday – Period 7/8
1. Observe the outcome of your agar test plates with E. Coli
2. Crime Scene Lab
3. Drosophila Lab –
12/18 – Wednesday Homework
1 Complete all questions on page 12 – 16 of the pGLO lab.
2: Carol to someone named Carol.
3. Complete the DNA Fingerprinting Lab
Pages: 1,3,4 (Skip page 8 questions. Put a Y through page 8) 12, 18, 21, 22, 23, and 24.
:
Christie and Morgan’s Tranformation Lab test plates: |
|
-pGlo – LB
E. Coli that DID NOT HAVE THE pGlO plasmid cultured on the original LB agarose medium. Bacteria grew as a biofilm instead of colonies as a result of too much of the E. Coli suspension added.
Proved Bacteria were viable.
|
-pGlo – LB/AMP
E.Coli that DID NOT HAVE THE pGlO plasmid cultured on LB agarose medium WITH AMPICILLIN.
There was no Bacteria colonies or biofilm.
Proved Bacteria are not ampicillin resistant. |
+pGlo – LB/Amp
E.Coli that DID HAVE THE pGlo plasmid cultured on the LB agarose medium WITH AMPICILLIN. Bacteria grew as colonies.
Proved that all bacteria were transformed due to
Ampicillin resistance. |
+pGlo – LB/Amp/Ara
E.Coli that did have the pGlo plasmid cultured on the LB ararose mediun WITH AMPICILLIN and AGAROSE. Bacteria had the Green Glowing allele.
Proved that agarose regulates the pGlo gene. |
|
End of Wednesday!
12/19 – Thursday – Period 7 – Academic Study Hall
Period 8
1. Complete the Crime Scene Lab
2. Blast Informatics activity
Blast Cladogram activity
|
Gene 1
|
Gene 2
|
|
Gene 3
|
Gene 4
|
12/19 – Thursday night Homework:
1. Complete Holiday Shopping for you tallest teacher!
*Remember Please do not be Rude or make me uncomfortable! LOL!
2. Please have the pGlo Lab and Crime Scene Lab completed.
End of Thursday!
12/20 – Friday- Period 7/8
1: Holiday DNA Extraction activity..
2. Blast Informatics activity
Blast Cladogram activity
|
Gene 1
|
Gene 2
|
|
Gene 3
|
Gene 4
|
12/20 – Friday- HOLIDAY BREAK Homework:
1. Please check the counter daily and fill the form below to prove your diligence.
Happy New Year!
End of week 7 and Year 2019!
1. CASE: NY23A-ER67-10299 DOCKET: 345-2788
Two different DNA samples were recovered in a horrific tragic traffic accident. Apparently, an elderly women was traveling home alone from a family gathering in December and was injured. The woman has been unconscious since the accident so there are no eyewitnesses. The crack WHB CSI team has collected a small sample of DNA from the scene. They have performed the technique of PCR (Polymerase Chain Reaction) to amplify the signal and they have Sequenced the entire DNA fragments which is given below.
Fragment 1: Found on clothing of victim
AGTTAAGCTGTACTACATCTAATGGATAACTACTTCAGTCTGACATGCTATTTTGGAGCAGACATCAGCAAACTCATGAACAAGAAGGACCCTAA
CAGTGTTTATCATTTTGCAAACACAGAACAAAAAGTTGATCCTATGTCAGTTAACGGTCTCTCTGCCACAAACAAAAAAAATGAGGGCTCGTGTG
GGATGATTTCTGCCAAGAGAGAGCCTGTCTCCCTGGAATATGTTTTCATGAGAAGAATAGTGGCCAGCTTAAACTGAGGCAATAGATGAAACCAG
ATAACATCTCAGAAGAGAAATATAATACTTTACTGGATGGAGTCCTGATGCAGAACTGAAAGAAAAGGAAGTAGGAAGGAAATTAAGATCCCAAA
GATGTATTCTTGGCCAGCATTCTTCTCTTTGGACTGATCTGCATGACCTGAACCTTGGGAACGTTATACTCTGGGATAAAAATGTTATTCTCCTCT
AATAAACAACAAAAGGTTGCAAGGCAAAGACATTTGATGACTTAACATCTAAGCTGCTCCTCATCCCAGAATAAAGAGAAGCAGGAATTTTGACAG
CTCCACTCCCTGTCAAATTTCTATGCATCAACATGCTCCACAATATTGAAGAAGTTT
Fragment 12: Found on the victim’s site of trauma
GAGTATGTTAAGAGCGAGTGTCATTTCTCCAACGGGACGGAGCGGGTGCAGTTCCTGAAG
AGATACATCCATAACGGAGAAGAGTTGGTGCGCTTCGACAGCGACGTGGGCGAGTTCCGG
GCGGTGACCGAGCTGGGGCGGCCGGTAGCCGAGGGCTGGAACAGCCGGAAGGACATTCTG
GAGGAGAAACGGGCCGCGGTGGACACGTTCTGCAGACACAACTACGGGGTCGGT
Cut and paste each DNA segment into the Blast Website to identify the possible individuals that may be responsible for the crime.
