Q2 – Week 7 – 20-21
week 7
Week of 1/4 – 1/8
*Please REFRESH this Page every time you view!!!
The 5 day – A, B, C, D cycle looks like this:
Day Period
7 8
In class: A Academic Study AP BIOLOGY
Remote: Academic Study AP BIOLOGY
In class: B AP BIOLOGY AP BIOLOGY
Remote: AP BIOLOGY AP BIOLOGY
In class: C AP BIOLOGY AP BIOLOGY
Remote: AP BIOLOGY AP BIOLOGY
Monday In class: D Academic Study AP BIOLOGY
Remote: Academic Study Academic Study
This week’s 5 day Schedule: I = In person, R = Remote
1/4 – Monday – “D” Day – period 7D,8D – I 7(D) AP BIO ACADEMIC STUDY / 7(B) 8(B,D) AP BIOLOGY
– period 7D,8D – R 7(D) REMOTE INS / 7(B) 8(B,D) AP BIOLOGY REMOTE INSTR
1/5 – Tuesday – “A” Day – period 7A, 8A – I 7(A) AP BIO ACADEMIC STUDY(ASH) / 7(C) 8(A,C) AP BIOLOGY
–period 7A, 8A -R 7 (A) REMOTE INSTR – ASH / 7(C) 8(A,C) 20-21 REMOTE INSTR
1/6 – Wednesday – “B” Day –period 7B, 8B– I 7(B) 8(B,D) AP BIOLOGY – (double period Lab)
-period 7B, 8B -R 7(B) 8(B,D) AP BIOLOGY – REMOTE INSTR
1/7 – Thursday – “C” Day – period 7C, 8C -I 7(C) 8(A,C) AP BIOLOGY – (double period Lab)
– period 7C, 8C –R 7(C) 8(A,C) AP BIOLOGY – REMOTE INSTR
1/8 – Friday – “D” Day – period 7D,8D – I 7(D) AP BIO ACADEMIC STUDY / 7(B) 8(B,D) AP BIOLOGY
– period 7D,8D – R 7(D) REMOTE INS / 7(B) 8(B,D) AP BIOLOGY REMOTE INSTR
1/4 – Monday – “D” Day – period 7D,8D – I 7(D) AP BIO ACADEMIC STUDY / 7(B) 8(B,D) AP BIOLOGY
– period 7D,8D – R 7(D) REMOTE INS / 7(B) 8(B,D) AP BIOLOGY REMOTE INSTR
Happy New Year!
I hope everyone enjoyed your break. Unfortunately one of my family members tested positive so I am quarantined and now everyone is distance learning in my classes.
This is why there is no Remote Instruction Page this week and probably next. I am very frustrated but I will do everything I can to keep us moving forward. Not the what I planned but life is about adjustments.
ZOOM Meeting Info for all classes:
Topic: AP Biology 1.04
Time: Jan 4, 2021 12:00 PM Eastern Time (US and Canada)
Join Zoom Meeting
https://us02web.zoom.us/j/86424939062?pwd=eUZCSGRQTzBNb01NMWtVOW8vZG5UUT09
Meeting ID: 864 2493 9062
Passcode: y5Gt2r
One tap mobile
+16465588656,,86424939062#,,,,*486499# US (New York)
1. Played the following animation of Transcription and reviewed Gene to Protein 1 Form through
the animation.
2. Review the mRNA activity!
mRNA activity student copy .pdf
Please Follow the Instructions below to complete the mRNA activity:
Please find your work in the back lab table under the light.
1. Complete the Template strand of the DNA by writing the correct complimentary code below the coding strand.
2. Connect a single stranded blank strand that is almost as long your DNA strand. This will be eventually be your mRNA but for now it will be your pre-mRNA (or primary transcript)
This blank strand sheet that needs to be cut out and assembled are on the first desk next to the scissors and tape box.
3. Mark on your DNA strand with a highlighter the promoter region and the termination sequence. If you forget what these small bits of code are for each then grab the text in Chapter 17 and look it up.
The promoter region is telling where to start represents the INITIATION step.
*When you look for this code it is helpful to look and the coding strand (The printed code above the Template strand that you filled in). The coding strand will reveal what the mRNA Strand will look like EXCEPT THAT thymine will be Uracil!
4. Lay your blank RNA strand along the Template Strand (that you filled out) and start making the RNA primary transcript from 15 or so UTR’s downstream from your promoter region. It must be in front of the start CODON: AUG which will look like ATG on the Coding strand! So start coding the mRNA strand remembering to use Uracil instead of THymine.
Writing the code on the single strand mRNA is the ELONGATION step.
5. Keep coding until you complete the terminating sequence. At this point your primary transcript (pre-mRNA) will be detached from the Template Strand of the DNA. This is where RNA polymerase detaches from the template strand of the DNA.
Stopping the code and detaching the pre-RNA is the TERMINATION step.
6. Now you have to make your pre-RNA into the processed mRNA that can leave the nucleus of a eukaryote cell and move into another area of the cell that will Translate the mRNA Codons into proteins.
Alteration of the mRNA Ends
7. You must modify the ends of this pre-mRNA. You may have look up in the text (page 334) or look below to remember how the ends of the RNA are modified. You may have to add some blank strands to the ends to make the caps.
This modification facilitates the export of the mRNA out of the nucleus, protects it from it being broken down by enzymes, and helps ribosomes to attach it for Translation.
RNA Splicing
8. On your pre-mRNA that has its end capped appropriately in step 7, use a highlighter to identify the EXONS. The Exons are the triplet codons that are expressed. In your packet you have the code for the entire gene including the start codon and stop codon. So highlight ONLY the Triplet CODON in the RNA strand that is in your packet or below.
|
A |
U |
G |
G |
U |
C |
G |
A |
A |
G |
U |
C |
A |
U |
U |
G |
C |
G |
U |
C |
G |
A |
A |
G |
C |
G |
C |
U |
G |
G |
|
U |
C |
U |
A |
A |
U |
A |
A |
G |
G |
G |
C |
G |
U |
G |
U |
U |
G |
G |
U |
C |
G |
A |
A |
G |
U |
C |
A |
U |
U |
|
G |
U |
C |
C |
C |
C |
G |
U |
C |
G |
A |
A |
A |
U |
C |
C |
G |
U |
U |
G |
G |
A |
G |
A |
C |
A |
U |
U |
G |
C |
|
G |
C |
U |
U |
A |
G |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
The code will go in order but it will have many UTR’s (Untranslated REgions) that are not part of the code and these are INTRONS!!!!
After you have highlighted all of the EXONS Physically cut away all of the INTRON in between the start and stop codon and retape (splice) the RNA back together so that there is a continuous code of EXONS from start to stop. At this point you are acting as snRNA (snurps) in a splicesome!
Your pre-mRNA IS NOW a mRNA and can leave the nucleus to begin Translation.
9. Roll up your DNA and completed mRNA and place on top of your packet with group names and return this back to the lab area you picked up your work today.
mRNA activity continues:
3. Mutations –
1: Mutations – completed the Mutation worksheet together
Substitutional Mutations:
Missense –
Silent –
Nonsense –
Reading Frame Mutations:
Insertions –
Deletions –
1/4 – Monday – “D” Day Homework –
1. Please make another submission to the last form that we had for homework last year (12/22).
End of Monday..
1/5 – Tuesday – “A” Day – period 7A, 8A – I 7(A) AP BIO ACADEMIC STUDY(ASH) / 7(C) 8(A,C) AP BIOLOGY
–period 7A, 8A -R 7 (A) REMOTE INSTR – ASH / 7(C) 8(A,C) 20-21 REMOTE INSTR
ZOOM Meeting Info for all classes:
Topic: AP Biology – 01.05 Periods 7,8
Time: Jan 5, 2021 12:00 PM Eastern Time (US and Canada)
Join Zoom Meeting
https://us02web.zoom.us/j/89184360322?pwd=VVIvdENrU2tLSnd0KytXQ3lEYUl5QT09
Meeting ID: 891 8436 0322
Passcode: WFQf7n
One tap mobile
+16465588656,,89184360322#,,,,*571347# US (New York)
Period 7:
1. Gene 2 protein form 2 review:
Hand back Gene to Protein Form 2 –
a) Connections of Alternative RNA Splicing – nematodes and us
b) having introns allows for an increased opportunity for Crossover to unlink for genes.
This might might provide more terrain from crossovers without
interrupting coding sequences.
c) exon shuffling – Exons could shuffle from one chromosome to another in crossover and with
Alternative RNA Splicing this might provide new combinations of exons and thus possibly new proteins that may have lead to evolutionary advantages.
2. View Gene to Protein presentation:
Translation:
3D animation:
3: Types of Mutations – (substitutional)
Complete the mutation worksheet
4: Start the homework
1/5 – Tuesday – “A” Day Homework:
1: Complete Form Below using the class text:
THis form is not in auto – reply.
End of Tuesday..
1/6 – Wednesday – “B” Day –period 7B, 8B– I 7(B) 8(B,D) AP BIOLOGY – (double period Lab)
-period 7B, 8B -R 7(B) 8(B,D) AP BIOLOGY – REMOTE INSTR
ZOOM Meeting Info for all classes:
Topic: AP Biology – 01.06 – period 7,8
Time: Jan 6, 2021 12:00 PM Eastern Time (US and Canada)
Join Zoom Meeting
https://us02web.zoom.us/j/88612004296?pwd=Ny91dWRFdlN4ME5QV3dlL3NaOCtQdz09
Meeting ID: 886 1200 4296
Passcode: wPMG31
One tap mobile
+16465588656,,88612004296#,,,,*781843# US (New York)
1. Lac Operon discussion –
2: trp operon opening discussion.
2. Students will complete another submission of last nights homework in class after I review the Lac operon and the Trp operon mechanisms.
Please use this one: its on auto-reply!
1/6 – Wednesday – “B” Day Homework:
1. Make one more submission to the form you completed in class.
It was on auto – reply so you should have the graded result to review.
2. Please watch the video below and complete the form:
If the video is blocked please use the following link to view the video:
End of Wednesday..
1/7 – Thursday – “C” Day – period 7C, 8C -I 7(C) 8(A,C) AP BIOLOGY – (double period Lab)
– period 7C, 8C –R 7(C) 8(A,C) AP BIOLOGY – REMOTE INSTR
ZOOM Meeting Info for all classes:
Topic: AP Biology – 01.07 – Periods 7,8
Time: Jan 7, 2021 12:00 PM Eastern Time (US and Canada)
Join Zoom Meeting
https://us02web.zoom.us/j/83802529821?pwd=bWRtVWk5R3I1N0taYit1NXVQYU1QZz09
Meeting ID: 838 0252 9821
Passcode: 789WC4
One tap mobile
+16465588656,,83802529821#,,,,*164123# US (New York)
1. Lactose tolerant Form Review:
2. Review of Gene Regulation form
3. Positive Control gene regulation – with worksheet.
1/7 – Thursday – “C” Day Homework
1. Please watch both short Lectures from a tall teacher.
2. Please FILL OUT THE FORM below. You may need the text book!
Lecture 1:
Lecture 2:
Tonights Form:
End of Thursday..
1/8 – Friday – “D” Day – period 7D,8D – I 7(D) AP BIO ACADEMIC STUDY / 7(B) 8(B,D) AP BIOLOGY
– period 7D,8D – R 7(D) REMOTE INS / 7(B) 8(B,D) AP BIOLOGY REMOTE INSTR
ZOOM Meeting Info for all classes:
Topic: AP Biology – 01.08 – Periods 7,8
Time: Jan 8, 2021 01:00 PM Eastern Time (US and Canada)
Join Zoom Meeting
https://us02web.zoom.us/j/83292617383?pwd=aTdnYk40Q09IVVlGaDRWdHB1ZUF0UT09
Meeting ID: 832 9261 7383
Passcode: cf6R1K
One tap mobile
+16465588656,,83292617383#,,,,*896751# US (New York)
1. Review Last nights form –
2. Classwork – Past Ap problem.
Form for answers:
1/8 – Friday – “D” Day Homework:
1: Please read the pGlO lab (transformation lab) pages 1 – 11 and answer the form below:
There will only be one submission!
End of Friday..and week 7!
NOT UPDATED BEYONd THIS POINT!
NOT UPDATED BEYONd THIS POINT!
NOT UPDATED BEYONd THIS POINT! –
period 7 – Academic Study Hall
period 8 –
I will be using the Academic Study hall for today for our
Gel electrophoresis Lab
1. Crime scene Lab – pouring the gels/intro
2: Micropippeting restrictive enzymes
3: incubating DNA and restrictive enzymes
4: Loading Gels
5: Gels are run in the afternoon 30 min at 100Volts
DNA Fingerprinting Lab period 6:
Standard Suspect #1 Suspect #2 Suspect #3 Suspect #4 Suspect #5 Crime Scene
Molecular Gavin Jack Morgan D Evan Kristina
Ladder
Who is guilty?
Emma and Theresa: |
Edgar and Evan |
Christie , Morgans |
Kristina, Gavin, Jack, Kade |
Max and Dan |
If you look at lane 4 (suspect 3) and lane 7 (CS), especially in Kristina’s group gel then it would be wise for Morgan D. to get a lawyer!
Homework:
1. Complete the FAST Plant (Lab 1).
Please include recombinant information.
Please include Genetic Drift information – allele frequency change from one generation to the next.
Fast Plant: Lab
P1: (this was the parents of our original seeds) : ANL/ANL YGR/YGR x anl/anl ygr/ygr
Purple Stems Green Leaves Green stems yellow leaves
F1: (this was the genotype of the seeds we first planted) : ANL/anl YGR/ygr x ANL/anl YGR/ygr
Carriers of the parental alleles
Purple Stems Green Leaves Purple Stems Green Leaves
F2: (this was the generation of the seeds of OUR second planting: There will be 4 different phenotypes:
Parental: Purple Stems, Green Leaves
Purple Stems, Yellow Leaves
Green Stems, Green leaves
Parental: Green Stems,Yellow leaves
When doing the % recombinants, remember that we are determining the parental phenotypes of the ORIGINAL Parental Generation (P1). The dihybrid cross is a cross of the carriers of the parental alleles.
Because both parents are undergoing recombination we will divide our percent recombinants by 2 to get the corrected percent recombinants (which will now represent the morgan unit on a gene map).
I will do a separate test cross with (homozygous recessive plants with F2) next year to provide better data!
END of Week 6!
– Period 7,8-
1: Data Collection of Crime Scene Lab, gels
2. Fly’s~
12/16 – Monday Homework:
1: Complete questions on DNA Fingerprinting lab on page 12 – Due Friday 12/21
You should have the following pages completed and handed in by Friday!
Pages: 1,3,4 (Skip page 8 questions. Put a Y through page 8) 12, 18, 21, 22, 23, and 24.
y – Period 7 – Academic Study Hall
Period 8
1: complete the Crime Scene Lab
2: Take out parents of our Drosophila cross so that they do not mate with the offspring!!
3: pGlo Transformation Lab-
a) obtain 2 micro test tubes, one labeled +pGlo and the other -pGlo
Little p means plasmid – small circular DNA of E. Coli.
b) Obtain your starter plates that you streaked yesterday that has been incubating for 24 hours at 37 degrees
Celsius.
c) Use a sterile loop and pick up a single colony and disperse into each tube, +pGLO and -pGlo.
d) I will add 10 micro liters of the pGlo plasmid (engineered sequence) to your +pGLO micro test tube.
e) Incubate the tubes on ice for 10 minutes.
f) label your lids.
g) heat shock, add broth, pippete and streak in the appropriate plates.
f) Stack up the plates, tape and label, then incubate for 24 hours.
Homework:
1: Please make a second submission to last nights pGlo’s form.
2: Please answer question in PGlo lab packet page 3 (questions 1 – 4) and page 12 (questions 1 – 4)
THis lab Packet is due this Friday!
3: Please complete form below based on Chapter 20 of your text:
End of Tuesday!
12/18 – Wednesday – Period 7/8
1. Observe the outcome of your agar test plates with E. Coli
2. Crime Scene Lab
3. Drosophila Lab –
12/18 – Wednesday Homework
1 Complete all questions on page 12 – 16 of the pGLO lab.
2: Carol to someone named Carol.
3. Complete the DNA Fingerprinting Lab
Pages: 1,3,4 (Skip page 8 questions. Put a Y through page 8) 12, 18, 21, 22, 23, and 24.
:
Christie and Morgan’s Tranformation Lab test plates: |
|
End of Wednesday!
12/19 – Thursday – Period 7 – Academic Study Hall
Period 8
1. Complete the Crime Scene Lab
2. Blast Informatics activity
Blast Cladogram activity
– Thursday night Homework:
1. Complete Holiday Shopping for you tallest teacher!
*Remember Please do not be Rude or make me uncomfortable! LOL!
2. Please have the pGlo Lab and Crime Scene Lab completed.
End of Thursday!
12/20 – Friday- Period 7/8
1: Holiday DNA Extraction activity..
2. Blast Informatics activity
Blast Cladogram activity
1. CASE: NY23A-ER67-10299 DOCKET: 345-2788
Two different DNA samples were recovered in a horrific tragic traffic accident. Apparently, an elderly women was traveling home alone from a family gathering in December and was injured. The woman has been unconscious since the accident so there are no eyewitnesses. The crack WHB CSI team has collected a small sample of DNA from the scene. They have performed the technique of PCR (Polymerase Chain Reaction) to amplify the signal and they have Sequenced the entire DNA fragments which is given below.
Fragment 1: Found on clothing of victim
AGTTAAGCTGTACTACATCTAATGGATAACTACTTCAGTCTGACATGCTATTTTGGAGCAGACATCAGCAAACTCATGAACAAGAAGGACCCTAA
CAGTGTTTATCATTTTGCAAACACAGAACAAAAAGTTGATCCTATGTCAGTTAACGGTCTCTCTGCCACAAACAAAAAAAATGAGGGCTCGTGTG
GGATGATTTCTGCCAAGAGAGAGCCTGTCTCCCTGGAATATGTTTTCATGAGAAGAATAGTGGCCAGCTTAAACTGAGGCAATAGATGAAACCAG
ATAACATCTCAGAAGAGAAATATAATACTTTACTGGATGGAGTCCTGATGCAGAACTGAAAGAAAAGGAAGTAGGAAGGAAATTAAGATCCCAAA
GATGTATTCTTGGCCAGCATTCTTCTCTTTGGACTGATCTGCATGACCTGAACCTTGGGAACGTTATACTCTGGGATAAAAATGTTATTCTCCTCT
AATAAACAACAAAAGGTTGCAAGGCAAAGACATTTGATGACTTAACATCTAAGCTGCTCCTCATCCCAGAATAAAGAGAAGCAGGAATTTTGACAG
CTCCACTCCCTGTCAAATTTCTATGCATCAACATGCTCCACAATATTGAAGAAGTTT
Fragment 12: Found on the victim’s site of trauma
GAGTATGTTAAGAGCGAGTGTCATTTCTCCAACGGGACGGAGCGGGTGCAGTTCCTGAAG
AGATACATCCATAACGGAGAAGAGTTGGTGCGCTTCGACAGCGACGTGGGCGAGTTCCGG
GCGGTGACCGAGCTGGGGCGGCCGGTAGCCGAGGGCTGGAACAGCCGGAAGGACATTCTG
GAGGAGAAACGGGCCGCGGTGGACACGTTCTGCAGACACAACTACGGGGTCGGT
Cut and paste each DNA segment into the Blast Website to identify the possible individuals that may be responsible for the crime.
